|
R&D Systems
il1β plus il1β neutralizing antibody ![]() Il1β Plus Il1β Neutralizing Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Human+IL-1+beta%2FIL-1F2+Antibody/pmc08125420-162-9-14 Average 95 stars, based on 1 article reviews
il1β plus il1β neutralizing antibody - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
R&D Systems
anti gapdh ![]() Anti Gapdh, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Mouse+CD27%2FTNFRSF7+Antibody/pmc07027090-44-42-46 Average 92 stars, based on 1 article reviews
anti gapdh - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Bio-Rad
human il 1β ab ![]() Human Il 1β Ab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Mouse+anti+Human+IL-1+Beta/pmc06482288-135-28-37 Average 93 stars, based on 1 article reviews
human il 1β ab - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Novus Biologicals
rabbit polyclonal anti cga ![]() Rabbit Polyclonal Anti Cga, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Chromogranin+A+Antibody+-+BSA+Free/pmc08807871-245-43-46 Average 94 stars, based on 1 article reviews
rabbit polyclonal anti cga - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
MyBiosource Biotechnology
recombinant slamf7 ![]() Recombinant Slamf7, supplied by MyBiosource Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/recombinant+slamf7/pmc10036139-395-37-43 Average 90 stars, based on 1 article reviews
recombinant slamf7 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Immunex Corporation
human recombinant il-1β ![]() Human Recombinant Il 1β, supplied by Immunex Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/human+recombinant+il+1b/pm10956548-41-0-6 Average 90 stars, based on 1 article reviews
human recombinant il-1β - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
HumanZyme
recombinant human (rh) il-1β ![]() Recombinant Human (Rh) Il 1β, supplied by HumanZyme, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/recombinant+human+il+6/pmc09889994-231-1-8 Average 90 stars, based on 1 article reviews
recombinant human (rh) il-1β - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Promega
human il-1β ![]() Human Il 1β, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/il+1%CE%B2/us10260044-460-9-11 Average 90 stars, based on 1 article reviews
human il-1β - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
R&D Systems
il 1β ![]() Il 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Recombinant+Human+IL-1+alpha%2FIL-1F1+Protein/pmc07511813-119-5-8 Average 95 stars, based on 1 article reviews
il 1β - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
R&D Systems
recombinant proteins recombinant mouse il 1β r d systems ![]() Recombinant Proteins Recombinant Mouse Il 1β R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Recombinant+Mouse+IL-1+beta%2FIL-1F2+Protein/pmc06691977-786-271-276 Average 96 stars, based on 1 article reviews
recombinant proteins recombinant mouse il 1β r d systems - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
R&D Systems
human il 1β ![]() Human Il 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+human+il-1%CE%B2+cat/Human+IL-1+beta%2FIL-1F2+Antibody/pm25695947-317-124-130 Average 95 stars, based on 1 article reviews
human il 1β - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: International Journal of Molecular Sciences
Article Title: The Blockade of Tumoral IL1β-Mediated Signaling in Normal Colonic Fibroblasts Sensitizes Tumor Cells to Chemotherapy and Prevents Inflammatory CAF Activation
doi: 10.3390/ijms22094960
Figure Lengend Snippet: ( A ) mRNA levels of IL1β in 13 colorectal cell lines (DLD1, LoVo, Colo-205, RKO, Co115, HCT-15, KM12C, Caco-2, HCT116, HT-29, SW480, SW620, and SW1116) and in a mean of 11 normal colonic fibroblasts (NCFs) and a mean of 15 carcinoma-associated fibroblasts (CAFs). Bars depicted mean + sd of four independent biological replicates of three technical replicates each. Expression is reported as relative values corrected by housekeeping gene expression (GAPDH). ( B ) mRNA levels of IL1β in NCFs (cultured alone; depicted as white bars), paired CAFs (from the same patient; black bars) and the NCFs cultured with DLD1 cells (in transwell inserts; dashed bars). Thus, we had six different triplets, consisting in NCF and CAF from the same patient, and the NCF cocultured with DLD1 cells. In addition, we show IL1β mRNA levels in cocultured DLD1 cells with each of the 6 NCFs, compared with the DLD1-monocultured controls. Bars depicted mean + sd of four independent biological replicates. Expression is reported as relative values corrected by housekeeping gene expression (GAPDH). ( C ) mean values of mRNA IL1β. After coculturing, DLD1 cells attain values like those in NCFs and CAFs. Cocultured NCFs also increase mRNA levels to the same values as CAFs (Mann–Whitney U test; Expression is reported as relative values corrected by housekeeping gene expression (GAPDH). ( D ) mRNA relative levels of IL1R1 receptor (in relation to housekeeping gene GAPDH) in 13 colorectal cell lines and in 7 NCFs. ( E ) Mean values of IL1R1 between colorectal cell lines and NCFs are significantly different ( p < 0.00001; Mann–Whitney U test). ( F ) mRNA levels of IL1R2 decoy receptor in 13 colorectal cell lines and in 7 NCFs. ( G ) Mean values of IL1R2 between colorectal cell lines and NCFs are significantly different ( p < 0.00001; Mann–Whitney U test). ( H ) mRNA levels of IL1R1 and IL1R2 increase after stimulation with IL1β in normal hepatic fibroblasts (NHFs) and NCFs. Conversely, stimulation in tumor cells produced no increase in either IL1β receptor. Bars depicted mean + sd of three independent replicates. Expression values adjusted by housekeeping gene expression (GAPDH). Data were normalized to each respective control without IL1β.
Article Snippet: For the NCF migration assay, IL1β (10 ng/mL) or
Techniques: Expressing, Gene Expression, Cell Culture, MANN-WHITNEY, Produced, Control
Journal: International Journal of Molecular Sciences
Article Title: The Blockade of Tumoral IL1β-Mediated Signaling in Normal Colonic Fibroblasts Sensitizes Tumor Cells to Chemotherapy and Prevents Inflammatory CAF Activation
doi: 10.3390/ijms22094960
Figure Lengend Snippet: ( A ) Representative western blot of phenotypic changes observed in NCF stimulated with IL1β. After 72 h IL1β-stimulation (10 ng/mL) NCF myofibroblasts lose myofibroblastic markers (αSMA, Calponin, Synpo2) and overexpress activated CAF marker fibroblast activating protein (FAP). The bar graph below depicted mean (plus standard deviation) normalized densities (using β-Actin as loading charge) for three independent western blot cell extracts, illustrating the decrease in myofibroblastic markers αSMA, Calponin, and Synaptopodin 2. ( B ) IL1β (10 ng/mL) induced tumor cell proliferation in only two of the seven colorectal cancer cell lines. Bars depicted mean + sd of four independent experiments of three replicates each. ( C ) Conversely, IL1β induced proliferation of NCFs in a 5-day WST-1 assay. These values could be restored by the addition of a P38 inhibitor (VX-702, 400 nM) and a neutralizing polyclonal antibody against IL1β (2 µg/mL) (Kruskal–Wallis, Dunn’s multiple comparison test; bars depicted mean + sd of four independent experiments of three technical replicates each). Selecting the cell lines that responded to (10 ng/mL) IL1β, we checked the dose–response effect of IL1β on proliferation and survival against IC 50 values for oxaliplatin (L-OHP), observing a dose–response trend only in HCT116 cells ( D ). IL1β did not induce any protection against L-OHP. No effect was observed in HT29 cells ( E ). Both D and E represent mean values + sd of three independent experiments of six technical replicates each. Assaying the effect of IL1β on fibroblast migration revealed a statistically significant increase in migration induced by the interleukin ( F ). We reported the same observation when analyzing directional migration of fibroblasts ( H ). This effect could be counterbalanced by the addition of a neutralizing polyclonal antibody against IL1β (2 µg/mL). Bars displayed mean values + sd of three independent experiments. Conditioned media from IL1β-stimulated NCFs induced the migration of tumor cells, both in a wound healing assay ( G ); white bar; bars displayed mean values + sd of three independent experiments; adj p value = 0.051) and directional migration in transwell, seeding NCFs in the bottom chamber ( I ); p = 0.0006, U Mann–Whitney test). ( J ) Representative western blot displaying that the blocking of IL1β with a polyclonal neutralizing antibody anti-IL1β (2 µg/mL) maintains the myofibroblastic phenotype in NCFs determined as the expression of αSMA and the decrease of FAP. The bar graph shows the mean + sd for three independent experiments not reaching statistical significance for FAP ( p = 0.06 after adjusting for multiple comparison), but significant for αSMA ( p = 0.021, after adjusting for multiple comparison; Kruskal–Wallis plus Dunn’s multiple comparison test).
Article Snippet: For the NCF migration assay, IL1β (10 ng/mL) or
Techniques: Western Blot, Marker, Standard Deviation, WST-1 Assay, Comparison, Migration, Wound Healing Assay, MANN-WHITNEY, Blocking Assay, Expressing
Journal: International Journal of Molecular Sciences
Article Title: The Blockade of Tumoral IL1β-Mediated Signaling in Normal Colonic Fibroblasts Sensitizes Tumor Cells to Chemotherapy and Prevents Inflammatory CAF Activation
doi: 10.3390/ijms22094960
Figure Lengend Snippet: ( A ) Panel with dose–response curves for L-OHP of six colorectal cancer cell lines cultured under standard conditions (black lines) or in the presence of (10 ng/mL) IL1β (grey lines). IL1β displaced the IC 50 values for L-OHP only in HT29 cells. Each dose–response curve corresponds to the mean of three independent experiments of six technical replicates each. Differences between mean ( n = 3) dose–response curves were compared with extra sum-of-squares F test (Log IC 50 ). Survival is reported as %. ( B ) Panel of four colorectal cell lines treated with conditioned medium (CM) from NCFs (black bars), IL1β-stimulated NCFs (dark grey bars), or IL1β-stimulated NCFs plus a neutralizing antibody against IL1β ((2 µg/mL); light grey bars). IL1β used at (10 ng/mL). For all cell lines tested, IL1β-stimulated NCFs CM promoted proliferation (left Y axis) of tumor cells, although the effect relative to control NCFs CM was only statistically significant in DLD1 and HCT116 cells. The right Y axis shows that, for all cell lines and drugs (L-OHP and 5FU), the viability of cells cultured with IL1β-stimulated NCFs CM was greater than that of controls (Kruskal–Wallis, Dunn’s multiple comparison test, adjusted P values), meaning that IL1β targets modified the sensitivity to both drugs. Such sensitivity was restored by the addition of a neutralizing IL1β antibody during NCF culture for CM production. Bars depicted mean + sd of four independent experiments of six technical replicates each. ( C ) The same observation as described in ( B ), in dose–response curves, where IL1β-stimulated (10 ng/mL). NCFs CM induced a shift in the IC 50 curves for L-OHP, leading to an increase in tolerance of cytotoxic compounds (left plot). Similar results were obtained for DLD1 and HCT116 using foreskin fibroblasts (middle and right graphs). Survival is reported as %. In both cases, dose–response curves correspond to the mean of three independent experiments.
Article Snippet: For the NCF migration assay, IL1β (10 ng/mL) or
Techniques: Cell Culture, Control, Comparison, Modification
Journal: International Journal of Molecular Sciences
Article Title: The Blockade of Tumoral IL1β-Mediated Signaling in Normal Colonic Fibroblasts Sensitizes Tumor Cells to Chemotherapy and Prevents Inflammatory CAF Activation
doi: 10.3390/ijms22094960
Figure Lengend Snippet: ( A ) colony forming assay of CCCL in transwell coculture with NCF. ( B ) quantification of colonies: Blocking the IL1β-mediated crosstalk between cocultures of NCF (upper 24 mm transwell chamber) and colorectal cancer cell lines (lower transwell chamber) with a neutralizing IL1β antibody sensitizes cancer cells to L-OHP. ( C ) Such IL1β blocking altered the composition of conditioned media (affecting IL1β targets), as illustrated in the bar graphs, where the neutralizing antibody affected the IL1β itself and IL6, as a surrogate marker of the IL1β response (grey bars), both soluble factors determined by ELISA in a mixture of coculture supernatants before 10% FBS reconstitution (proportional volume of the different CM from NCF with either DLD1, HT29, or HCT116 cells). ( D ) Western blot of HT29 cells cultured with control CM (Ø) or IL1β-stimulated NCF-conditioned medium (10 ng/mL of IL1β) or same condition with the addition of a polyclonal neutralizing antibody against IL1β (2 µg/mL). FBS-free DMEM/F12 was used to generate conditioned medium after 48 h NCFs culture with or without the presence of the neutralizing antibody. Such conditioned media were then used to stimulate JAK2, STAT3, or AKT in HT29 cells for 1 h or 3 h. Quantification of phosphoproteins for three independent experiments was performed normalizing first for total JAK2, STAT3, or AKT and then normalizing for Tubulin (data expressed as arbitrary units). Statistical significance was assessed using non-parametric Kruskal–Wallis + Dunn’s multiple comparison test. ( E ) In 48 h experiments, the same conditioned media were reconstituted at 10% FBS. We evaluated JAK/STAT target proteins, Cyclin D1, and cMyc. ( F ) Overview of the experiment: to confirm paracrine signaling mediated by tumor cell-derived IL1β, we cocultured NCFs and HT29 cells with a defective secretion of IL1β, (silenced by means of shRNA) or transfected with a mock vector or wild-type as controls (75 mm transwell inserts, 3µm pore-size). As a positive control, we added IL1β to cocultures with HT29-shIL1β and NCFs. Culture conditions were: 2 × 10 6 cells tumor cells in the lower chamber and fibroblasts in the upper chamber (10 6 cells) in FBS-free DMEMF12. After 48 h, we harvested the conditioned medium and reconstituted the 10% FBS. As illustrated in ( G ), the conditioned medium obtained from cocultured NCFs and IL1β-deficient tumor cells (Ht29shIL1β) yielded lower IC 50 values in dose–response assays compared with the other experimental conditions tested ( p < 0.0001; survival is reported as %). The conditioned media obtained from cocultures of NCF and HT29-shIL1β cells with the exogenous addition of IL1β restored the IC 50 values of cocultured with HT29 wild-type cells. Each dose–response curve corresponds to the mean of three independent experiments of six technical replicates each. Differences between dose–response curves were compared with extra sum-of-squares F test (Log IC 50 ). ( H ) Real-Time PCR of the aforementioned cocultured NCF’s reported that the inhibition of the IL1β-mediated crosstalk between HT29shIL1β cells and fibroblasts induced a myofibroblastic phenotype in NCFs, with increased expression of ACTA2, CNN1, PDPN, and MYH11, while inflammatory markers were diminished, evidenced by decrease in IL6, LIF, and CCL2 (Kruskal–Wallis test; adjusted P values after Dunn’s multiple comparison test).
Article Snippet: For the NCF migration assay, IL1β (10 ng/mL) or
Techniques: Blocking Assay, Marker, Enzyme-linked Immunosorbent Assay, Western Blot, Cell Culture, Control, Comparison, Derivative Assay, shRNA, Transfection, Plasmid Preparation, Pore Size, Positive Control, Real-time Polymerase Chain Reaction, Inhibition, Expressing
Journal: International Journal of Molecular Sciences
Article Title: The Blockade of Tumoral IL1β-Mediated Signaling in Normal Colonic Fibroblasts Sensitizes Tumor Cells to Chemotherapy and Prevents Inflammatory CAF Activation
doi: 10.3390/ijms22094960
Figure Lengend Snippet: ( A ) Dose–response curves of L-OHP treated DLD1, HT29, and HCT116 cells cultured in NCF control conditioned media, IL1β-stimulated NCF conditioned media or TGFβ1-stimulated NCF conditioned media. For all cell lines tested, IL1β-treated NCFs conditioned media induced an increase in the IC 50 values against L-OHP, while values for TGFβ1-treated NCFs media did not differ from NCF control conditioned media. Each dose–response curve corresponds to the mean of three independent experiments of four technical replicates each. Differences between dose–response curves were compared with extra sum-of-squares F test (Log IC 50 ). ( B ) Colony forming assay of DLD1 cells (seeding density, 400 cells in twelve-well plates). We cultured cell lines with the aforementioned conditioned media in the presence of two different L-OHP concentrations. The quantification of the colonies reported that IL1β-treated NCFs conditioned media produced more colonies than TGFβ1-treated NCF’s conditioned media (Kruskal–Wallis test plus Dunn’s multiple comparison test, adjusted P values). ( C ) The expression values of different iCAF and myCAF markers were assessed by means of quantitative PCR in treated NCFs, showing that IL1β treated fibroblast acquired traits of iCAF, with the exception of CLEC3B and GSN, genes attributed to iCAFs in different publications . Results expressed as fold changes in relation to normalized control.
Article Snippet: For the NCF migration assay, IL1β (10 ng/mL) or
Techniques: Cell Culture, Control, Produced, Comparison, Expressing, Real-time Polymerase Chain Reaction
Journal: Acta Neuropathologica
Article Title: Post-stroke inflammation—target or tool for therapy?
doi: 10.1007/s00401-018-1930-z
Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and
Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker
Journal: Acta Neuropathologica
Article Title: Post-stroke inflammation—target or tool for therapy?
doi: 10.1007/s00401-018-1930-z
Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke
Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and
Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection
Journal: Acta Neuropathologica
Article Title: Post-stroke inflammation—target or tool for therapy?
doi: 10.1007/s00401-018-1930-z
Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke
Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and
Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant
Journal: Acta Neuropathologica
Article Title: Post-stroke inflammation—target or tool for therapy?
doi: 10.1007/s00401-018-1930-z
Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor
Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and
Techniques: Sequencing
Journal: Acta Neuropathologica
Article Title: Post-stroke inflammation—target or tool for therapy?
doi: 10.1007/s00401-018-1930-z
Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor
Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and
Techniques: Modification
Journal: Nature nanotechnology
Article Title: Immunological conversion of solid tumours using a bispecific nanobioconjugate for cancer immunotherapy
doi: 10.1038/s41565-022-01245-7
Figure Lengend Snippet: a, Schematic of the nanoparticle-based conversion strategy via anti-HER2 antibody targeting and SLAMF7 labeling of HER2-expressing cancer cells. b, Size distribution of unconjugated PEG-PLGA nanoparticles (NPs) and BiTNHER measured by dynamic light scattering. The increased size indicated the successful conjugation of antibody/protein onto the NP surface. c, Gel electrophoresis of unconjugated NP and NP conjugated with anti-HER2 antibody (HER-NP), SLAMF7 (S-NP), and both (BiTNHER). Experiment was repeated twice with similar results between repeats. d, HER-NP labeling of the HER2-expressing human breast cancer cell line SK-BR-3. (Left) Confocal images of HER2low MDA-MB-468 cells and HER2high SK-BR-3 cells after incubation with IgG-NP or HER-NP. Green, NPs; blue, DAPI (scale bar, 50 μm). (Right) FACS semiquantitative analysis of binding. e, BiTNHER labeling of HER2-expressing SK-BR-3 cells with SLAMF7. (Left) Confocal images of HER2low MDA-MB-468 cells and HER2high SK-BR-3 cells after incubation with IgG-SLAMF7-NP or HER-SLAMF7-NP. Cells were stained with anti-SLAMF7 antibody and anti-human IgG antibody (scale bar, 50 μm). Higher-magnification image of SK-BR-3 cells in the outlined area (scale bar, 20 μm). (Right) FACS semiquantitative analysis of binding. f, Binding affinity of nanoparticles with different HER:SLAMF7 conjugation ratios to HER2-expressing SK-BR-3 cells. The dissociation constant Kd increased when the conjugation ratio of anti-HER2 antibody decreased.
Article Snippet: To synthesise conjugated NPs, amine-reactive polymers were directly added into and reacted with PBS solution containing anti-HER2 antibodies (the human monoclonal anti-HER2 antibody trastuzumab from Genentech or the mouse monoclonal anti-HER2/neu antibody clone 7.16.4 from BioXcell), or
Techniques: Labeling, Expressing, Conjugation Assay, Nucleic Acid Electrophoresis, Incubation, Binding Assay, Staining
Journal: Nature nanotechnology
Article Title: Immunological conversion of solid tumours using a bispecific nanobioconjugate for cancer immunotherapy
doi: 10.1038/s41565-022-01245-7
Figure Lengend Snippet: a, BiTNHER with a 3:1 SLAMF7:HER conjugation ratio had the maximum pro-phagocytosis effect of human THP-1 against HER2-expressing SK-BR-3 cancer cells in the presence of aCD47 (n=3). b, BiTNHER converted HER2/neu-expressing human (SK-BR-3) and mouse (EO771/E2) breast cancer cells into SLAMF7high cells and promoted human THP-1 or mouse (C57BL6 bone marrow) macrophage phagocytosis in the presence of aCD47, comparable with the SLAMF7-expressing mouse leukemia L1210 cells (n=3). c, Anti-SLAMF7 antibody abrogated the pro-phagocytosis effect of BiTNHER and aCD47 on HER2-expressing cancer cells (n=3). d, Phagocytosis of CFSE-labelled HER2low EO771 and HER2high EO771/E2 mouse breast cancer cells and SLAMF7high L1210 mouse leukemia cells by mouse bone marrow macrophages in the presence of aCD47 after treatment with NP alone, NP with unconjugated anti-HER2 antibody and SLAMF7, or BiTNHER. Red, macrophages; green, cancer cells (scale bar, 50 μm). e, BiTNHER with aCD47 promotes macrophage phagocytosis against HER2-expressing breast cancer cells. f, Macrophages had increased antigen presentation of the H2kb-SIINFEKL complex after phagocytosis of BiTNHER -treated HER2-expressing EO771/E2-cOVA cells. Green, macrophages; red, H2kb-SIINFEKL complex (scale bar, 50 μm). g, Combination of BiTNHER and aCD47 increased macrophage antigen presentation of HER2-expressing cancer cells (n=4). h,i, BiTNHER with aCD47 promoted the priming of cOVA antigen-specific T cells (left) and induced a shift in naive T cells towards memory T cells (right) (n=4). For all figures, data are presented as mean±s.e.m.; **P<0.01, ***P<0.001, and ****P<0.0001 by one-way ANOVA with a Bonferroni post hoc correction. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by unpaired Student’s t-test for the indicated comparisons; n.s., not significant.
Article Snippet: To synthesise conjugated NPs, amine-reactive polymers were directly added into and reacted with PBS solution containing anti-HER2 antibodies (the human monoclonal anti-HER2 antibody trastuzumab from Genentech or the mouse monoclonal anti-HER2/neu antibody clone 7.16.4 from BioXcell), or
Techniques: Conjugation Assay, Expressing